CloneSet247


Clone Mass	Clones in CloneSet	Parameter Count	Clone Similarity	Syntax Category [Sequence Length]
24	3	2	0.977	compound_stmt

Clone Abstraction

Parameter Bindings

Clone Instance (Click to see clone)	Line Count	Source Line	Source File
1	16	482	Bio/Seq.py
2	16	499	Bio/Seq.py
3	24	516	Bio/Seq.py

Clone Instance
1

Line Count
16

Source Line
482

Source File

Bio/Seq.py

    def strip(self,chars = None): 
         '''Returns a new Seq object with leading and trailing ends stripped.

        This behaves like the python string method of the same name.

        Optional argument chars defines which characters to remove.  If
        ommitted or None (default) then as for the python string method,
        this defaults to removing any white space.
        
        e.g. print my_seq.strip("-")

        See also the lstrip and rstrip methods.
        ''' 
         #If it has one, check the alphabet:
         strip_str = self._get_seq_str_and_check_alphabet(chars) 
         return Seq(str(self).strip(strip_str),self.alphabet)

Clone Instance
2

Line Count
16

Source Line
499

Source File

Bio/Seq.py

    def lstrip(self,chars = None): 
         '''Returns a new Seq object with leading (left) end stripped.

        This behaves like the python string method of the same name.

        Optional argument chars defines which characters to remove.  If
        ommitted or None (default) then as for the python string method,
        this defaults to removing any white space.
        
        e.g. print my_seq.lstrip("-")

        See also the strip and rstrip methods.
        ''' 
         #If it has one, check the alphabet:
         strip_str = self._get_seq_str_and_check_alphabet(chars) 
         return Seq(str(self).lstrip(strip_str),self.alphabet)

Clone Instance
3

Line Count
24

Source Line
516

Source File

Bio/Seq.py

    def rstrip(self,chars = None): 
         """Returns a new Seq object with trailing (right) end stripped.

        This behaves like the python string method of the same name.

        Optional argument chars defines which characters to remove.  If
        ommitted or None (default) then as for the python string method,
        this defaults to removing any white space.
        
        e.g. Removing a nucleotide sequence's polyadenylation (poly-A tail):

        >>> from Bio.Alphabet import IUPAC
        >>> from Bio.Seq import Seq
        >>> my_seq = Seq("CGGTACGCTTATGTCACGTAGAAAAAA", IUPAC.unambiguous_dna)
        >>> my_seq
        Seq('CGGTACGCTTATGTCACGTAGAAAAAA', IUPACUnambiguousDNA())
        >>> my_seq.rstrip("A")
        Seq('CGGTACGCTTATGTCACGTAG', IUPACUnambiguousDNA())

        See also the strip and lstrip methods.
        """ 
         #If it has one, check the alphabet:
         strip_str = self._get_seq_str_and_check_alphabet(chars) 
         return Seq(str(self).rstrip(strip_str),self.alphabet)

Clone Abstraction

Parameter Count: 2

Parameter Bindings

def [[#variable600fb7e0]](self,chars = None):
   [[#variable600fb620]]
  #If it has one, check the alphabet:
  strip_str = self._get_seq_str_and_check_alphabet(chars) 
  return Seq(str(self). [[#variable600fb7e0]](strip_str),self.alphabet)

CloneAbstraction

Parameter Bindings
Parameter Index	Clone Instance	Parameter Name	Value
1	1	`[[#600fb7e0]]`	rstrip
1	2	`[[#600fb7e0]]`	lstrip
1	3	`[[#600fb7e0]]`	strip
2	1	`[[#600fb620]]`	"""Returns a new Seq object with trailing (right) end stripped. This behaves like the python string method of the same name. Optional argument chars defines which characters to remove. If ommitted or None (default) then as for the python string method, this defaults to removing any white space. e.g. Removing a nucleotide sequence's polyadenylation (poly-A tail): >>> from Bio.Alphabet import IUPAC >>> from Bio.Seq import Seq >>> my_seq = Seq("CGGTACGCTTATGTCACGTAGAAAAAA", IUPAC.unambiguous_dna) >>> my_seq Seq('CGGTACGCTTATGTCACGTAGAAAAAA', IUPACUnambiguousDNA()) >>> my_seq.rstrip("A") Seq('CGGTACGCTTATGTCACGTAG', IUPACUnambiguousDNA()) See also the strip and lstrip methods. """
2	2	`[[#600fb620]]`	'''Returns a new Seq object with leading (left) end stripped. This behaves like the python string method of the same name. Optional argument chars defines which characters to remove. If ommitted or None (default) then as for the python string method, this defaults to removing any white space. e.g. print my_seq.lstrip("-") See also the strip and rstrip methods. '''
2	3	`[[#600fb620]]`	'''Returns a new Seq object with leading and trailing ends stripped. This behaves like the python string method of the same name. Optional argument chars defines which characters to remove. If ommitted or None (default) then as for the python string method, this defaults to removing any white space. e.g. print my_seq.strip("-") See also the lstrip and rstrip methods. '''